Prévalence et facteurs de risque pour l’ADNémie des bétaherpesvirus chez les enfants & gt; Semaines et & lt; Années d’admission dans un grand hôpital de référence en Afrique subsaharienne

Contexte Les bêtaherpesvirus sont des causes établies de morbidité et de mortalité chez les patients immunodéprimés, mais peu étudiés en Afrique subsaharienne, épicentre du virus de l’immunodéficience humaine VIH pandémique Dans cette région, infections primaires par cytomégalovirus humain HCMV et herpèsvirus humain de type HHV sont endémiques dans la petite enfance, mais l’impact clinique de ces infections chez les patients hospitalisés pédiatriques est mal caractérisé et supposé, basé principalement sur les données des populations occidentales. Méthodes Nous avons utilisé la réaction en chaîne par polymérase TaqMan pour dépister les sérums d’un groupe de patients hospitalisés âgés de plusieurs semaines. Nous rapportons la prévalence de l’ADNémie et des charges virales au sein de ce groupe de patients, et évaluons les associations cliniques / facteurs de risque possibles d’infections à herpèsvirus bêta chez ces enfants hospitalisés. Résultats Nous avons détecté une β-éthinémie bêta-herpèsvirus en% des enfants HCMV le plus répandu ent%, suivi du rapport de cotes HHV-B%, HHV-% et HHV-A% infection par le VIH [OR],; % intervalle de confiance [CI], -; P =, ayant une insuffisance pondérale OU; % CI, -; P =, et un diagnostic d’admission de la méningite suspectée OU, % CI, -; Inversement, HHV-B et HHV-DNA n’ont pas été associés au VIH, à un poids insuffisant ou à un diagnostic d’admission. La charge virale médiane du HCMV était modérément mais significativement plus élevée chez les enfants infectés par le VIH. Conclusions: ADNmémie du HCMV très prévalente était indépendamment associé à l’infection par le VIH et souffrait d’insuffisance pondérale dans tous les groupes d’âge, et était également associé à la méningite, avec des implications précédemment sous-estimées pour la santé et le développement des enfants africains

CMV, HHV-, VIH, malnutrition, méningite Les betaherpesvirus humains, cytomégalovirus humain [HCMV] et herpesvirus humain [HHV] types A, B, sont des causes importantes de morbidité chez les enfants, et HCMV et HHV- sont des causes bien établies de morbidité et mortalité, chez les patients immunodéprimés , mais ils ont été peu étudiés en Afrique subsaharienne, la région de l’Organisation mondiale de la santé avec la charge pédiatrique la plus élevée et aussi l’épicentre du virus de l’immunodéficience humaine VIH pandémique primaire HCMV et HHV- sont endémiques Le grand défi de la virologie herpétique est de différencier les infections actives causant la pathologie de la virémie subclinique de base. A cette fin, les derniers diagnostics moléculaires quantitatifs sont utilisés pour établir les taux de latence. seuils de charge virale cliniquement informatifs dans différents groupes de patients et dans différents compartiments, qui peuvent informer le traitement Les betaherpesvirus sont fortement associés aux cellules et dans les groupes de patients vulnérables, la détection des charges élevées d’HCMV et d’HHV-sérique dans le sérum est révélatrice d’infections actives liées à de mauvais résultats , mais absence ou faible charge virale dans le sérum n’exclut pas l’infection localisée limitée à des compartiments spécifiques Des études prospectives récentes et un examen attentif de certaines études plus anciennes mais négligées ont conduit à une prise de conscience croissante de l’importance des infections à HCMV dans les milieux à forte séroprévalence. mortalité chez les enfants infectés par le VIH et cause de retard de développement et de perte auditive chez les enfants par des infections congénitales ou infantiles précoces, avec une infection maternelle par le VIH et une numération CD inférieure associée à une prévalence plus élevée d’infections congénitales [ ,] HHV-A, HHV-B et HHV- ont été moins bien étudiés en Afrique subsaharienne HHV-B infection primaire et dans une moindre mesure, HHV- est l’agent étiologique de l’exanthème su bitum, une maladie infantile endémique caractérisée par de la fièvre, de la diarrhée et une éruption cutanée , et fortement associée à des convulsions fébriles incluant un état épileptique fébrile HHV-A est rare chez les enfants en Europe, aux États-Unis et Au Japon, une étude récente a révélé que le virus HHV-A était endémique chez les nourrissons zambiens en bonne santé Ailleurs, le HHV-A est plus fréquent chez les adultes immunodéprimés et des études récentes sur des modèles animaux ont suggéré des rôles possibles pour le HHV-A dans l’immunodéficience. [En Afrique subsaharienne, les hôpitaux de référence tertiaires concentrent un grand nombre d’enfants gravement malades issus de communautés urbaines appauvries Dans ces centres, des médicaments pour contrôler le VIH, la tuberculose, le paludisme et d’autres infections bactériennes, fongiques et parasitaires courantes sont largement disponibles, mais les taux de mortalité restent élevés Les diagnostics rapides et le traitement des infections virales sont largement indisponibles , mais le HCMV est une cause importante de maladie respiratoire chez les enfants africains infectés par le VIH [,,,], et HHV- et HHV- sont des causes possibles d’infections du système nerveux central non malin du SNC. La pneumonie à HCMV peut être traitée avec succès. les nourrissons sud-africains immunodéprimés infectés par le VIH avec infection à HCMV confirmée et les enfants immunocompétents Il existe des médicaments anticytomégalovirus génériques dans le pipeline, et l’activité antibactérienne a été rapportée pour plusieurs alternatives peu coûteuses telles que l’artésunate et l’immunostimulant Nous présentons ici les données d’un large groupe d’enfants admis à l’hôpital universitaire de Lusaka, en Zambie, dans le but de déterminer la prévalence de l’ADNémie des betaherpesvirus et des charges virales, et d’identifier les associations cliniques possibles et les facteurs de risque.

Méthodes

Approbation éthique

L’étude a été approuvée par le Comité d’éthique de la recherche biomédicale de l’École de médecine de l’Université de Zambie, Lusaka somatisation. Les mères / tuteurs de tous les participants ont donné leur consentement éclairé.

Conception et établissement d’une étude

Nous avons mené une étude observationnelle rétrospective pour déterminer la prévalence, les charges virales et les facteurs de risque associés à l’ADNemia beta herpesvirus chez les enfants admis à l’hôpital universitaire de Lusaka, en Zambie Nous avons sélectionné des échantillons de sérum biobanque chez des enfants âgés de les patients hospitalisés en pédiatrie, qui avaient participé à un essai de diagnostic de la tuberculose , les ont dépistés pour tous les bêtaherpesvirus et ont mesuré les charges virales. Le degré de représentativité des enfants recrutés dans la population les données des dossiers d’admission généraux

Extraction de l’ADN et analyse de la réaction en chaîne de la polymérase

L’ADN du sérum a été extrait à l’aide du QIAamp DNA Mini Kit Qiagen, Hilden, Allemagne, comme décrit précédemment Des contrôles d’extraction ont été inclus dans chaque échantillon. La qualité de l’extraction d’ADN a été contrôlée sur chaque échantillon. Les échantillons ont été testés pour détecter la présence de HCMV, HHV-A, HHV-B et HHV en utilisant différents tests PCR de réaction en chaîne de la polymérase en temps réel TaqMan en temps réel comme décrit [,,] Séquences oligonucléotidiques et La fidélité de l’enzyme PCR et la pureté de l’extraction de l’ADN ont été contrôlées grâce à l’amplification du gène ménager, la β-actine, à partir de chaque échantillon Des étalons positifs produits commercialement, de l’eau de qualité moléculaire négative, un réactif sans matrice et des contrôles d’extraction ont été inclus L’ADN génomique du HCMV a été acheté auprès de l’Institut national pour les normes biologiques et le contrôle Potters Bar, Royaume-Uni L’ADN génomique pour HHV-A, HHV-B et HHV- a été donné par le dépôt de réactifs de la Fondation HHV Santa Barbara, Californie Des courbes standard pour la quantification de charges virales de betaherpesvirus ont été préparées comme suit: pour HCMV, l’étalon lyophilisé a été remis en suspension dans un tampon d’élution selon les instructions du fabricant pour créer une solution mère de standards de HHV-A, HHV-B et HHV Des sérums humains contenant × copies / mL Deux cents microlitres ont été extraits et reconstitués dans des μL de tampon d’élution. Pour tous les virus, des dilutions en série ont été effectuées jusqu’à × copies / mL. Cinq microlitres de chaque dilution,, et puis amplifié en triple exemplaire Le logiciel du fabricant a ensuite été utilisé pour générer des courbes standard par rapport auxquelles les valeurs de seuil de cycle des échantillons cliniques ont été converties en copies par micro litre d’ADN extrait L’ADN extrait des échantillons cliniques a été quantifié ng / μL en utilisant un Nanodrop Thermo Scientific, et des équivalents de génome viral par microgramme d’ADN extrait ont été calculés

Tableau Séquences oligonucléotidiques et conditions de thermocyclage Cibles cibles et sondes ‘-‘ Conditions de cycle HCMV UL Amorce avant CAGTCCCGAGACMGTGAGAC Tenir @ ° C, min. Amorce inverse TGAACATCCCCAGCATCAACG Répétitions cycliques Sonde: FAMb-TGCCACATCTGCTTGCCCGACGC-BBQb Étape @ ° C, maintenir s Étape @ ° C, maintenez s Étape @ ° C, maintenez s HHV-A et HHV-B Amorce avant GGAGTGCCTGTGGGTATTC Maintenez @ ° C, min Amorce inverse CTAAGGTGAGCCAGATTCG Répétition cyclique Sonde HHV-A: HEX-TGCAGCCATTTCTTTGGAAAGC-TAMRA Étape @ ° C, maintenez s Sonde HHV-B: FAM-TGCAGCCACCTCCTTGGAAAG-TAMRA Etape @ ° C, maintenez s HHV- Amorce directe TTTCCTGTGACAAAAGAAGCAGTTA Maintenez @ ° C, min Amorce inverse ATCCCACACGCTTTACGGG Répétition cyclique Sonde: FAM-TTCCTGCGCAATAAAGTGAAAACTGTTAGCATT-TAMRA Étape @ ° C, maintenez s Etape @ ° C, tenir s β-actine Amorce avant: CACACTGTGCCCATCTACGA Tenir ° C min Amorce inverse: CTCAGTGAGGATCTTCATGAGGTAGT Cycles cycliques Sonde: FAM-ATG CCCTCCCCCATGCCATCCTGCGT-TAMRA Étape @ ° C Étape @ ° C Cible s Primaires cibles et sondes ‘-‘ Conditions de cycle HCMV UL Primaire vers l’avant CAGTCCCGAGACMGTGAGAC Hold @ ° C, min. Reverse Primer TGAACATCCCCAGCATCAACG Répétitions cycliques Sonde: FAMb-TGCCACATCTGCTTGCCCGACGC-BBQb Étape @ ° C, maintenez s Étape @ ° C, maintenez s Étape @ ° C, maintenez s HHV-A et HHV-B Amorce avant GGAGTGCCTGTGGGTATTC Maintenez @ ° C, min Amorce inverse CTAAGGTGAGCCAGATTCG Répétition cyclique Sonde HHV-A: HEX-TGCAGCCATTTCTTTGGAAAGC- TAMRA Étape @ ° C, maintenez s Sonde HHV-B: FAM-TGCAGCCACCTCCTTGGAAAG-TAMRA Étape @ ° C, maintenez s HHV- Amorce avant TTTCCTGTGACAAAAGAAGCAGTTA Maintenez @ ° C, min Amorce inverse ATCCCACACGCTTTACGGG Répétition cyclique Sonde: FAM-TTCCTGCGCAATAAAGTGAAAACTGTTAGCATT-TAMRA Étape @ ° C, maintenez s Étape @ ° C, maintenez s β-actine Amorce avant: CACACTGTGCCCATCTACGA Tenir ° C min Amorce inverse: CTCAGTGAGGATCTTCATGAGGTAGT Cycles cycliques Sonde: FAM-ATGCCCTCCCCCATGCCATCCTGCGT-TAMRA Etape @ ° C Etape @ ° C maintenez s Abréviations: HCMV, cytomégalovirus humain; HHV, virus de l’herpès humainVoir Grand

Analyses statistiques

L’analyse des données a été réalisée en utilisant le logiciel SPSS, la version IBM, Armonk, New York Binary et les variables continues ont été comparées respectivement par le test de Pearson et le test de Mann-Whitney, entre les groupes d’étude et la population générale admise. les variables ont été calculées en utilisant la formule [prévalence dans la population hospitalière / prévalence dans l’échantillon] puis multipliées et divisées par le poids moyen pour faire une variable de pondération composite Ce poids composite a ensuite été utilisé pour estimer les prévalences pondérées en population hospitalière pour chacun des betaherpesvirus Une analyse de régression logistique binaire multivariée sur des données non pondérées a été utilisée pour évaluer les associations possibles entre divers facteurs cliniques et démographiques et l’infection à bêtaherpesvirus et les charges virales. Le test de Wald-Wolfowitz a été utilisé pour évaluer le caractère aléatoire de la distribution des échantillons positifs. Statut VIH et underwei état ght à l’aide du test U de Mann-Whitney

Tableau Comparaison des variables descriptives clés entre le groupe d’étude et la population admise Groupe d’étude variable Population admise Aucune date Juin -Avril Avril-mai Sexe féminin /% /% Âge médian IQR, mo -a -a Infection par le VIH chez le nourrisson /% b /% b Mortalité ND /% Malnutrition notée à l’admission /% c /% c Groupe d’étude variable Population admise No Dates Juin -Avril Avril-Mai Sexe féminin /% /% Âge médian IQR, mo -a -a Infection VIH infantile /% b /% b Mortalité ND /% Malnutrition notée à l’admission /% c /% c Lorsque les dénominateurs diffèrent de la taille totale de l’échantillon, ceci représente les données manquantes pour cette variable. La signification était par Pearson χ test pour les variables binomiales, Mann-Whitney U test de poids à la naissanceAbbreviations: VIH, virus de l’immunodéficience humaine; IQR, intervalle interquartile; ND, pas de dataaP & lt; bp & lt; cP & lt; Voir grand

RÉSULTATS

Recrutement des patients

Nous avons criblé des sérums extraits d’ADN d’enfants âgés de plusieurs semaines à des âges différents. L’âge médian était de mois interquartile [IQR], – mois,% d’enfants étaient des femmes,% étaient infectés par le VIH, et% souffraient de malnutrition , admis dans le service de malnutrition en raison du score z poids-pour-taille & lt; – ou pour des raisons cliniques à la discrétion du médecin traitant La comparaison avec ces données d’admissions de routine a montré que même si le sexe était représentatif, les enfants étaient significativement plus âgés, plus susceptibles d’être infectés par le VIH et plus susceptibles d’être mal nourris. des facteurs de risque de la tuberculose ou de la tuberculose infection par le VIH, contact avec le ménage, etc., qui étaient des critères d’inclusion clés dans l’essai parent

Prévalence des infections à bêtaherpesvirus

Betaherpesvirus DNAemia a été détecté par PCR dans les sérums de% / des enfants Tableau Tous les contrôles négatifs ont été négatifs, et les échantillons positifs ont été distribués aléatoirement analyse non montrée HCMV était le virus le plus prévalent% [/], significativement plus prévalente que HHV-B% [/ ] P & lt; et HHV-% [/] P & lt; La pondération pour la surreprésentation des enfants infectés par le VIH, l’âge médian plus élevé et l’augmentation de la prévalence de la malnutrition n’a pas affecté significativement la prévalence de la bêtaherpesvirus. Le tableau HHV-A était rare, avec un bébé de sexe masculin admis avec suspicion de pneumonie, tuberculose, ou coqueluche Une aspiration gastrique était culture négative pour la tuberculose; La mère a rapporté une perte récente d’appétit et de perte de poids, des fièvres, une toux productive, des difficultés respiratoires et une léthargie. Ce bébé était également positif pour le HCMV et le HHV-, de seulement les bébés positifs pour betaherpesvirus Cinquante-deux cas ont été co-infectés par des virus Tableau

Tableau Betaherpesvirus Prévalence stratifiée par statut sérologique Virus Non pondéré, Non%, SE Weighteda, Non%, SE VIH Non infectéb, Non%, SE VIH Infectedb, Non%, SEP Valeur Tout betaherpesvirus /, /, /, /, Totaux HCMV /, c, d /, /, /, HHV-A /, /, /, / HHV-B /, c /, /, /, HHV- /, d /, /, /, coïncidences HCMV HHV-B /, /, /, /, HCMV HHV- /, /, /, /, HHV-B HHV- /, /, /, /, HCMV HHV-B HHV- /, /, /, /, HCMV HHV-A HHV- /, /, /, /, Virus non pondéré, Non%, SE Weighteda, Non%, SE VIH non infectéb, Non%, SE infecté par le VIHb, Non%, SEP Valeur Tout betaherpesvirus /, /, /, /, Totaux HCMV / , c, d /, /, /, HHV-A /, /, /, / HHV-B /, c /, /, /, HHV- /, d /, /, /, Coïncidences HCMV HHV-B / , /, /, /, HCMV HHV- /, /, /, /, HHV-B HHV- /, /, /, /, HCMV HHV-B HHV- /, /, /, /, HCMV HHV-A HHV- /, /, /, /, L’importance est de Pearson χ testAbbreviations: HCMV, cytomégalovirus humain; HHV, herpesvirus humain; VIH, virus de l’immunodéficience humaine; SE, erreur type Pondérée pour les biais de recrutement en fonction de l’âge, du statut VIH du nourrisson et de la malnutrition à l’admissionb Données non pondérées stratifiées par statut VIHcP & lt; dP & lt; Voir grand

Facteurs de risque des infections à bêtaherpesvirus

L’ADNmc du HCMV était significativement plus fréquente chez les enfants infectés par le VIH que chez les enfants non infectés par le VIH% [/] vs% [/]; P =, un effet univarié non observé pour HHV-B ou HHV- Table L’analyse de régression logistique binaire multivariée a démontré que l’ADNmc du HCMV chez les enfants était indépendamment associée au rapport de cotes d’infection par le VIH [OR],; % intervalle de confiance [CI], -; P = et l’insuffisance pondérale OU; % CI, -; P = Tableau Parmi les enfants admis avec suspicion de méningite, étaient positifs pour l’ADNmc HCMV OU; % CI, -; P = Dans notre groupe d’étude, betaherpesvirus DNAemia n’a pas été associé à la fièvre ≥ ° C, l’allaitement maternel étant une voie de transmission établie pour le HCMV, bien que seuls les enfants n’aient pas été allaités ou n’aient pas été allaités. présenté avec une table d’éruption

Tableau Analyse multivariée binaire de régression logistique des facteurs de risque associés à l’ADNémie des bétaherpesvirus dans les admissions pédiatriques & lt; Facteur de risque des années d’âge HCMV & gt; Copies / ml Sera HHV-B & gt; Copies / mL Sera HHV- aOR% CI P Valeur aOR% CI P Valeur aOR% CI P Valeur Sexe masculin – – – infecté par le VIH – – – Fièvre ≥ ° C – – – insuffisance pondérale WAZ & lt; – – – – Age, mois – – – Allaitement – – – Éruptions cutanées au cours du dernier mois – – – Diagnostic à l’admission Pneumonie – – – Diarrhée aiguë déshydratation – – – Paludisme – – – Méningite – – NC NC Facteur de risque HCMV & gt ; Copies / ml Sera HHV-B & gt; Copies / mL Sera HHV- aOR% CI P Valeur aOR% CI P Valeur aOR% CI P Valeur Sexe masculin – – – infecté par le VIH – – – Fièvre ≥ ° C – – – insuffisance pondérale WAZ & lt; – – – – Age, mois – – – Allaitement – – – Éruptions cutanées au cours du dernier mois – – – Diagnostic à l’admission Pneumonie – – – Diarrhée aiguë déshydratation – – – Paludisme – – – Méningite – NC NC Odds of betaherpesvirus infections n’étaient pas affectés par l’état de la tuberculose infantile L’analyse de tous les virus a été ajustée pour tenir compte des effets de l’âge, du statut VIH du nourrisson et de l’insuffisance pondérale, tel que défini par un WAZ & lt; -Abbreviations: aOR, odds ratio ajusté; CI, intervalle de confiance; HCMV, cytomégalovirus humain; HHV, herpesvirus humain; VIH, virus de l’immunodéficience humaine; NC, non calculable; WAZ, poids pour l’âge z scorea Des enfants admis avec suspicion de méningite, étaient positifs pour HCMV, étaient positifs pour HHV-B, et aucun n’était positif pour HHV-View LargeLes chances de HCMV DNAemia ont diminué significativement avec l’âge OU; % CI, -; P =, avec une tendance similaire pour HHV-B Inversement, il y avait une tendance à l’augmentation de l’HCl-HHV avec l’âge Pour étudier ces tendances de l’âge plus en détail, nous avons tracé la prévalence de l’ADNemia betaherpesvirus par âge en mois. Prévalence du HCMV à mois et mois, indiquant une primo-infection primaire avec une ADNmd résiduelle d’infections congénitales suivie d’une réactivation / réinfection chez les enfants plus âgés Une prévalence plus élevée d’ADNmc du HCMV était associée à l’infection VIH Figure B et l’insuffisance pondérale Figure C dans tous les âges groupes

Figure Vue grandDownload slideA, Betaherpesvirus prévalence stratifiée par âge parmi les enfants admis & lt; ans B, cytomégalovirus humain Prédominance de l’HCMV stratifiée par âge et virus de l’immunodéficience humaine Statut VIH chez les enfants admis C, prévalence de l’HCMV stratifié par âge et insuffisance pondérale chez les enfants admis Abréviations: HHV, herpesvirus humain; WAZ, score z de poids par âgeFigure View largeTélécharger slideA, Betaherpesvirus prévalence stratifiée par âge parmi les enfants admis & lt; ans B, cytomégalovirus humain Prédominance de l’HCMV stratifiée par âge et virus de l’immunodéficience humaine Statut VIH chez les enfants admis C, prévalence de l’HCMV stratifié par âge et insuffisance pondérale chez les enfants admis Abréviations: HHV, herpesvirus humain; WAZ, score z du poids pour l’âgeHHV-B a montré un profil temporel similaire à HCMV, avec des pics suggérant des infections primaires et secondaires Figure A La signature temporelle de l’HHV-DNAemia était clairement distincte de HCMV et HHV-B, passant de% à % au cours des premiers mois de la vie, mais ensuite augmenter progressivement à% par mois, et reste stable Figure A Coïncidences avec & gt; betaherpesvirus étaient communs, détectés dans% / de tous les cas avec des virus, et des cas avec des virus, mais les enfants infectés par le VIH n’étaient pas plus susceptibles d’avoir une double ou triple infection que les enfants VIH non infectés. Corrélation HCMV et HHV-B Pearson; P =, l’ADN de HHV-B étant associée à une probabilité accrue d’ADNmc de l’HCMV, contrôlée pour le statut VIH, l’âge et le score WAZ OR; % CI, -; P = données non affichées

Charges virales

En comparant les charges virales, telles que définies par les équivalents du génome de betaherpesvirus par microgramme d’ADN extrait, nous avons trouvé les charges virales les plus élevées pour les copies de HHV-median / μg d’ADN; IQR, – suivi de la médiane HCMV, copies / μg d’ADN; IQR, – La charge virale médiane du HHV-B était supérieure d’un log inférieur à celle de la médiane du HCMV, copies / μg d’ADN; IQR, – Tableau et Figure A L’échantillon positif unique de HHV-A présentait une charge virale relativement élevée d’équivalents génomiques par microgramme extrait ADN Stratification par statut VIH, la charge virale médiane de HCMV était significativement plus élevée chez les enfants infectés par le VIH Figure B VIH non infectée: médiane, [% IC, -] vs VIH infecté: médiane, [% IC, -]; P = Inversement, la charge virale médiane de l’HCMV ne différait pas significativement d’après WAZ P =; données non affichées

Tableau Betaherpesvirus Charges Equivalents génomiques / μg Équivalents d’ADN génomique extrait / mL Médiane du sang total IQR Min Max Médiane IQR Min Max HCMV a, b – – HHV-A – – HHV-B a, c – – HHV- b, c – – Génome Équivalents / μg Extraits d’ADN de génome / mL Médiane de sang total IQR Min Max Médiane IQR Min Max HCMV a, b – – HHV-A – – HHV-B a, c – – HHV-b, c – – Abréviations: HCMV, humain cytomégalovirus; HHV, herpesvirus humain; IQR, rangeaP interquartile & lt; Mann-Whitney U testbP & lt; Mann-Whitney U testcP & lt; Mann-Whitney U testVoir en grand

Figure Vue grandeTélécharger la diapositiveA, Betaherpesvirus génomes copies par microgramme d’ADN extrait B, Betaherpesvirus copies du génome stratifiées par le virus de l’immunodéficience humaine VIH statut Dans les deux panneaux, les cases indiquent interquartile gamme, et les moustaches indiquent les percentiles th et th; les cercles représentent les aberrations Abréviations: HCMV, cytomégalovirus humain; HHV, herpesvirus humainFigure Voir en grandDownload, Betaherpesvirus génomes copies par microgramme d’ADN extrait B, Betaherpesvirus génome copies stratifiées par le virus de l’immunodéficience humaine statut VIH Dans les deux panneaux, boîtes indiquent interquartile gamme, et moustaches indiquent th et th centiles; les cercles représentent les aberrations Abréviations: HCMV, cytomégalovirus humain; HHV, herpesvirus humain

DISCUSSION

L’association de l’infection à HCMV avec un diagnostic d’admission de la méningite est intéressante et soulève la question de savoir dans quelle mesure l’HCMV provoque la méningite chez les enfants africains, et si elle doit être diagnostiquée et traitée. Une étude précédente a également montré que Parmi les enfants exposés au VIH, ceux qui restent séronégatifs mais qui ont des mères infectées par le VIH, le HCMV est lié à une altération du développement psychomoteur D’autres rapports d’Afrique subsaharienne ont identifié le HCMV et le HHV parmi d’autres infections virales comme causes importantes d’hospitalisation Les études ont montré que la détection de l’ADN du HCMV dans le liquide céphalorachidien des patients suspectés de méningite est associée à la mortalité des adultes et des enfants En ce qui concerne le HHV-B, nos résultats sont en accord avec une vaste étude menée aux États-Unis qui a démontré une infection à HHV active chez% des nourrissons admis avec une maladie fébrile. Des études menées en Zambie avec des échantillons de plus petite taille ont détecté l’ADN HHV dans le sang total de% -% d’enfants admis avec une maladie fébrile Le séquençage classique sur une région hypervariable du locus U identifie HHV-A en% -% qui ont été séquencés avec succès Cette indication que le virus HHV-A pourrait être une infection infantile prévalente en Afrique a été suivie par une étude de population d’enfants en bonne santé, qui a identifié HHV-A en% / dont les cas étaient co-infectés par HHV-. B et HHV-B en% / des nourrissons chez lesquels HHV- a été détecté et typé avec succès À la lumière de ces résultats précédents, nous avons été surpris de constater une prévalence si faible de HHV-A. Nous avons détecté HHV-A et HHV-B en utilisant un test de PCR en temps réel multiplex basé sur TaqMan hautement sensible et spécifique avec des amorces conservées mais des sondes spécifiques à l’espèce ciblant le gène HHV-ADN polymérase U Chez les patients co-infectés, l’utilisation d’amorces conservées peut masquer l’espèce avec numéro de copie inférieur , mais cela seul est peu susceptible d’expliquer le contraste saisissant entre les études. Il existe quelques preuves limitées dans le gène U ​​pour les isolats contenant à la fois des éléments HHV-A et HHV-B, bien que globalement, les séquences génomiques complètes pour HHV- a été publié pour les souches: HHV- est intégré dans les répétitions télomériques d’environ% des populations européennes et% des populations japonaises, typiquement caractérisées par de fortes charges d’ADN HHV- dans les échantillons cliniques Aucun des échantillons positifs HHV sur Cette étude a montré des charges virales log / μg ADN qui pourraient être compatibles avec l’intégration chromosomique La distribution de la prévalence de betaherpesvirus par âge a montré des profils d’infection primaire précoce avec HCMV et HHV-B culminant entre et mois, suivi d’infection secondaire ou réactivation chez les enfants & gt; mois Pour HCMV, ceci est cohérent avec les études africaines précédentes mais différent des populations à haut revenu où l’infection HCMV survient plus tard Pour HHV-B, nos données sont en accord avec une étude américaine . distincte du HCMV et du HHV-B, la plupart des primo-infections apparaissant chez les jeunes nouveau-nés, suivie d’une augmentation régulière des infections réactivées probables au cours de la première année de vie et d’une prévalence très stable d’environ% chez les enfants admis. Nous présentons les premières données sur les infections à HHV chez les enfants africains, et la distribution par âge est cohérente avec les données sérologiques du Brésil , mais contrairement aux données américaines, qui suggèrent que l’infection primaire avec HHV- pics plus tard que HHV-B Il y avait plusieurs limites à cette étude: L’analyse d’un seul échantillon de sérum empêche la détermination détaillée de l’évolution clinique et virologique des infections à betaherpesvirus individuelles. Les tests diagnostiques utilisés ne permettent pas de différencier précisément les infections actives causales de pathologies et l’ADNm subclinique due aux infections réactivées secondaire à d’autres infections et maladies De même, en l’absence de données sérologiques, nous ne pouvons pas confirmer si les infections individuelles étaient primaires ou secondaires, bien que nous puissions en déduire une indication de la présence d’infections primaires et secondaires. comparaisons considérablement renforcées de la prévalence et des charges virales autres études Nous n’avons pas eu accès au statut VIH maternel empêchant la comparaison de la pertinence des infections à HCMV chez les enfants exposés au VIH, vu dans des études précédentes , et nous n’avons pas pu déterminer combien d’infections ont été contractées in utero. WAZ Malgré ces limites, nos résultats ajoutent du poids à des études antérieures qui démontrent que les infections à HCMV à la fois les infections congénitales [et] et les infections infantiles [ ,,,,] sont en train de devenir des déterminants importants de la santé et du développement chez les enfants africains

Remarques

Remerciements Les auteurs reconnaissent le soutien de Kristin Loomis, directeur exécutif de la Human Herpesvirus Foundation, Californie, et le Dr Sylvester Sinyangwe, chef du département de pédiatrie à l’University Teaching Hospital JT et MB ont rédigé le premier projet MK, MC, LC, CC et AZ ont fait des contributions substantielles pour étudier la conception, l’acquisition des données, l’analyse et l’interprétation, et tous les auteurs ont fait des révisions importantes à la version finale du soutien financier. Le travail des parents a été financé par EuropeAid grâce à la détection active de SANTE // – JT, MK, MC, LC, MB et AZ ont également bénéficié du soutien du Partenariat des pays européens et en développement sur les essais cliniques grâce à la subvention Tuberculose NEAT et de l’UBS Optimus Foundation, Suisse AZ. Conseil de recherches médicales; University College London Hospitals Centre de recherche biomédicale intégré de l’UCLH; UE-FP; et les Réactifs de la Fondation du Service National de Santé de l’UCLH pour le dépistage des betaherpesvirus ont été financés par des dons philanthropiques de Kids Here & amp; Columbus, Ohio Conflits d’intérêts potentiels Tous les auteurs: Aucun conflit signaléTous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués